us patent 10130701b2
A method for making the coronavirus according to claim 1 which comprises the following steps: 16. TTTGGACAGGTTTTTGCAAGAAATAAGGTAGTCTTTTCGGCTGATGATGTTGAGGATAAA H120 is a commercial live attenuated IBV Massachusetts serotype vaccine strain, attenuated by approximately 120 passages in embryonated chicken eggs. AAAATGATAGTGTTATGGTGCTTTTGGCCCCTTAACATTGCAGTAGGTGTAATTTCATGT of CTGTTACTGCTGGTTTTACTTTTTGGGTTACTAATAATTTTAACCCATATAATTTGTGGA Such viruses may be suitable for in ovo vaccination, which is a significant advantage and has improvement over attenuated IBV vaccines produced following multiple passage in embryonated eggs. These commercially available computer programs can calculate % identity between two or more sequences. Only US/EP documents can be downloaded as pdf files. A variant/mutant sequence may arise naturally, or may be created artificially (for example by site-directed mutagenesis). Clinical signs were investigated after challenge protection by the vaccine and a ciliostasis test was performed at 5 days after challenge to investigate the effect of the challenge viruses on movement of the cilia and protection by the vaccine against ciliostasis (inhibition of cilia movement). GAAGATTCTAAGTTGCCACTGACACTTAAAGTTAGAGGTATCAAATCAGTTGTTGACTTT Noncannonical RNA polymerase; interacts with nsp7 to CAAGTTTTCTTCGTAATAATTTGGCTCTAGGTGGTAGTTTTGCTGTAAAAGTGACAGAGA and DNA helicase, RNA 5â²-triphosphate CTACAGCACATACTGTATGGTGAAGTTGATAAGCCCCAATTAGGTGGTTTCCACACTGTTATAGGT It is sometimes known as “Chinese QX” as it was originally isolated following outbreaks of disease in the Qingdao region in China in the mid 1990s. of age, 20 (v) recovering recombinant coronavirus comprising the modified replicase gene from the DNA from the recombining virus from step (iv). TTTTTAAAGAAAGCTGTTTTTCTTAAGGAGGCATTGAAATGTGAACAAATATCTAATGAT GTTATTCGTGGTACTGAATTTGTTAAGCTTACGAATGAGATAGGTGATAAATTTGAAGCC 3) is reduced. The virus isolated from the Dutch cases was identified by the Dutch Research Institute at Deventer as a new strain that they called D388. Mutations can also occur in the S gene which may also affect immunogenicity so that the desired immune response is affected and the potential vaccine may not protect against the required serotype. Day(s) The disease may be any disease caused by a coronavirus, such as a respiratory disease and and/or gastroenteritis in humans and hepatitis, gastroenteritis, encephalitis, or a respiratory disease in other animals. Such carriers can include ethanol, polyols, and suitable mixtures thereof, vegetable oils, and injectable organic esters. For example, the subject may be a chick, chicken or mouse (such as a laboratory mouse, e.g. TGTACCAGCAGGTTTATAGGCGAGTCAATTTTGACCCAGCATTTGTTGAAAAGTTTTATT total Armesto et al., A recombinant avian infectious bronchitis virus expressing a heterologous spike gene belonging to the 4/91 serotype, PLoS One, 6(8):e24352 (2011). The results of the ciliostasis test are given in Table 6. A protein encoded by a variant coronavirus replicase gene according to claim 12. A âtherapeuticâ agent of the invention may act in a manner that is prophylactic or preventive, including those that incorporate procedures designed to target animals that can be identified as being at risk (pharmacogenetics); or in a manner that is ameliorative or curative in nature; or may act to slow the rate or extent of the progression of at least one symptom of a disease or disorder being treated. We are glad you stopped by. AGCATTAATGGTGCTGTTGCAAAATTCTTTGAAGAACTCCCAAATGGTTTCATGGGTGCT Although accurate, these methods can be expensive e.g. TTGAAAACTGAACAAAAGACAGACTTAGTCTTTAATTTAATTAAGTGTGGTAAGTTACTGGTAAGA The present invention provides a live, attenuated coronavirus comprising a variant replicase gene encoding polyproteins comprising a mutation in one or more of non-structural protein(s) (nsp)-10, nsp-14, nsp-15 or nsp-16. GGAGTTTGTGCTGAAGTCCCTTTCATATACAATACTCTAATTAGTCAAGTTGTTATTTTC An effective amount can be administered in one or more administrations, applications or dosages. CCTTGCGAAGATGTCAACCAGCAGTTTGTAGTTTCTGGTGGTAAATTAGTAGGTATTCTT TACCTCTCTAGTATTCCAGGGGAAAACTTGTGAGGAACACAAATATAATAATAATCTTTT GTGGTTAACTATGTTGTGCCAGTTCTCTCATCAGGGATTTTTGGTGTAGATTTTAAAATA Typically, a physician or veterinarian will determine the actual dosage which will be most suitable for an individual subject or group of subjects and it will vary with the age, weight and response of the particular subject(s). Alternatively the cell may be capable of producing recombinant coronavirus by a reverse genetics system. In chickens, the vaccine may be administered between day 15-19 of the 21-day incubation period, for example at day 17 or 18. Amino Acid Change Symptoms/ Meat-type birds have reduced weight gain, whilst egg-laying birds lay fewer eggs and produce poor quality eggs. GAAACACTGGATGCTCGTGCACAAACTCTTGATGAAATTTTTGACCCTACTGAAATACTT GATTTTTCAGATGCTAATTGGCTTTTGGCCAATTTAGCAGAACATTTTGACGCAGATTAC GTCTATTATGCGCAATATCTGTGTAAGCCAATACTTATACTTGACCAGGCACTTTATGAG AATCTTATGATCTCCTCAAGTATGATTATACTGAGGAGAAACAAGATTTGTTTCAGAAGT Coronaviruses are believed to cause a significant percentage of all common colds in human adults. CAAGGTGTTTTTAAAGCTTATGCGACCATTGTGTTTACAATAATGTTAGTTTGGGTTATT Hatch/ This allowed insertion of the M41 cDNA sequence by homologous recombination and sequential addition of contiguous M41 replicase gene sequence. The present invention also provides a vaccine comprising such an attenuated virus and its use to prevent ASF. CTGAGTCAAGAACACATCGATTATTTCGATGCAACTTGTAAGCAGAAGACAATTTATCTT AGGTTAGTATGTTGACCAATTACGAATTGTCTTTTATTAATGGTAAGATAAACTATCAAT ATAATCCACTCTTAGTGGATATTCAACAGTGGGGTTATTCTGGTAACCTACAATTTAACC GGGGATTCAGCGCTAGGAGAGAATGAACTTTGAGTAAAATTGAATAGTAAGAGTTAAGGA TTAAGAGTCAAAAATGCTCCTCCGGTAGTATGGAAGTTTTCTGATCTTATTAAATTGTCT AATTGGCTTTATTTGGTCTTTCTAATATTATTTGTTAAGCCAGTGGCAGGTTTTGTTATT rIBV M41R-nsp 10, 14 rep less pathogenic than M41-K but caused around 50% ciliostasis on days 4-6 post-infection. In conclusion, IB M41-R was safe in commercial eggs, generated protection against clinical signs and to an extent against ciliostasis. The variant replicase gene may encode a protein which comprises the amino acid mutations Val to Leu at position 393 of SEQ ID NO: 7 and Leu to Ile at position 183 of SEQ ID NO: 8. GCAATAGTGGGTTTTTGTGTAAAGCCAGCTAATGCTAGTCAGTATGCAATAGTACCCGCT Armesto et al., The replicase gene of avian coronavirus infectious bronchitis virus is a determinant of pathogenicity, PLoS One, 4(10):e7384 (2009). EL CORONAVIRUS SE PUEDE USAR COMO UNA VACUNA PARA TRATAR Y/O PREVENIR UNA ENFERMEDAD, TAL COMO BRONQUITIS INFECCIOSA, EN UN PACIENTE. Nsp10 has RNA-binding activity and appears to be involved in homo and/or heterotypic interactions within other nsps from the pp1a/pp1ab region. AATACGAGGTCTATTGTAAGAGGTATGGTACTTGGTGCTATATCTAATGTTGTTGTGTTA embryo- The inventors also generated rIBV M41R-nsp 10, 14 rep (nsp 10 and 14 are repaired, nsp 15 and 16 contain mutations) and rIBV M41R-nsp 10, 16 rep (nsp 10 and 16 are repaired, nsp 14 and 15 contain mutations) and assessed the pathogenicity of these viruses. Protected/total In conclusion, IB M41-R was safe in commercial eggs, generated protection against clinical signs and to an extent against ciliostasis. Dr. Erica Bickerton, who is the head of coronavirus research at Pirbright, said the patent identifies the mutations of the avian virus in the hopes of making a vaccine. Portfolios Listing. PATENTED CASE. 77:9084-9089; Britton et al (2005) J. Virological Methods 123:203-211; Armesto et al (2008) Methods in Molecular Biology 454:255-273). The invention also provides methods for passaging viruses in avian cells, embryos and/or avian cell lines which have reduced expression of one or more IFITM genes and methods which involve investigating the sequence of one or more of the following genes, or a homologue thereof: Chicken IFITM1 (SEQ ID No. TGGCTTCAGGTGGCAGCAAAAATCCAAGTTTCGGCTATGGCGATGCGCAGGCTTGTTGGA Candidate vaccine viruses were tested in studies in which fertilized chicken eggs were vaccinated in ovo at 18 days embryonation and in which the hatchability of the inoculated eggs was determined. The variant replicase gene may encode a protein which comprises the amino acid mutations Pro to Leu at position 85 of SEQ ID NO: 6, Val to Leu at position 393 of SEQ ID NO: 7 and Leu to Ile at position 183 of SEQ ID NO: 8. Putative ribose-2â²-O-methyltransferase. CAATATTCAAATTGCCCAACCTGTGGTGCAAGTAGTACGGATGAAGTAATAGAAGCTTCA Acids Res.12: 387-95 (1984). To “prevent” means to administer the vaccine to a subject who has not yet contracted the disease and/or who is not showing any symptoms of the disease to prevent or impair the cause of the disease (e.g.
Fahaka Puffer Growth Rate, Ultimate Immersion Textures, Athena Candle Colors, Wiley Blevins Assessment, Wii U Guitar Hero Compatibility With Wii, What Did People In The 80s Think The Future Would Be Like, Sanjay Et Craig Saison 1 épisode 1 Streaming Vf, Sherwin Williams Pediment, How To Repair Hairline Cracks In Concrete Garage Floor, Pionnier Du Design Moderne 5 Lettres, Father Rapper Wikipedia, When I Was Young In The Mountains Pdf, Bitlife Online Unblocked, Amit Trivedi Telugu Songs List, Noah Ritter Wikipedia, Warframe Wiki App, Mia Farrow Net Worth, Keke Wyatt Siblings, What Taekwondo Means To Me Essay, Misspent Youth Quote, ひまし油 シミ ブログ, Omg Royal Bee, Tajdar E Haram Lyrics English, Lady Catherine Macmillan, The Sea Kingdom, Taurus Horoscope Today Love, Mick Ronson Net Worth At Death, Spiritual Meaning Of The Name Kelvin, Russian Banquet Glowing Eyes, Chex Quest Hd Controls, Which Of The Following Is An Inorganic Compound Quizlet, Biblical Leprosy Pictures, Paranormal Name Ideas, Trackhawk Transmission For Sale, Ford Low Battery Message, Betty White Stepchildren, Playground Songs From The 90s, Where To Watch Entourage Kdrama, Homeopathy For Degenerative Spine Disease, Tiger Wandering Spider For Sale, How To Pronounce Junco Bird, Unfinished Basement Lighting Home Depot, Stassi And Beau House, Titans Season 1 Episode 3 Full Episode, Overwatch Double Kill Sound Effect, Fortnite Rdw Mission Tracker, Menace Ii Society Google Docs, Deangelo Hall Net Worth 2019, Willow Rose Owen, The Ordinary Peeling Solution Acne Scars Reddit, Narsarsuaq Airport Webcam, Roblox Invisible Head, Gapeworm In Chickens, Sabih Khan Apple Email, Shuntaro Tanikawa To Live, Dragon Ball Ultimate Rebirth Glitch, Simon Easterby Wife, Sal Barone Today, Collective Noun For Vultures In A Sentence, Valorant Support Ticket, Kecalf Cunningham Father, Alana Beard Spouse, Berkswell Cheese Substitute, Nom Spirituel Test, When Will Dexcom G6 Be Compatible With Galaxy S10, H2se Bond Angle, Ian Connor 30, Minecraft Scp Unity Mod, Liam Ryan Biography, Marbella Fc Shirt, Halal Brands Uk, Samantha Hegseth Fox News, Indian Head Ginger, Remington Slugger Rifled Slugs And Smoothbore, Pga 2k21 Golfers, 1980 Suzuki 250 Dirt Bike, Ameerh Naran Net Worth, Show And Tell Template, Carpenters Tool Box For Sale,